Knockout of the caspase Eight associated protein 2 gene improves recombinantprotein expression in HEK293 cells

aabioetica

Dynamics of serological responses to outlined recombinantproteins all through Schistosoma mansoni an an infection in mice sooner than and after the treatment with praziquantel

To do away with schistosomiasis, acceptable diagnostic assessments are required to observe its prevalence and transmission, significantly throughout the settings with low endemicity ensuing from the consecutive mass drug administration. Antibodies that react with each crude soluble schistosome egg antigens or soluble worm antigen preparations have been used to observe an an infection in low-prevalence areas.

  • Nonetheless, these detection methods can’t discriminate current and former infections and are cross-reactive with completely different parasites because of every antigens embody fairly just a few proteins and glycans from schistosomes, and regular preparations need maintenance of the life cycle of the schistosome.
  • To guage the potential utility of 9 recombinant Schistosoma mansoni proteins as single outlined antigens for serological evaluation, we monitored the kinetics of antibodies to each antigen all through S. mansoni an an infection in mice sooner than and after the treatment with praziquantel. C57BL/6 mice had been contaminated with 50 cercariae.
  • The levels of immunoglobulin G (IgG) raised in the direction of 5 recombinant antigens (RP26, sm31, sm32, GST, and LAP1) significantly elevated as early as 2-4 weeks after an an infection and shortly declined by 2 weeks after the treatment, whereas these raised in the direction of crude S. mansoni egg antigens or completely different antigens remained elevated prolonged after the treatment.
  • The IgG1 raised in the direction of RP26, sm31, and serpin decreased after the treatment with praziquantel, whereas the IgE raised in the direction of serpin declined strikingly after the treatment. This analysis clarifies the dynamics of the serological responses to recombinant S. mansoni proteins all through an an infection and after the treatment with praziquantel and identifies a variety of candidate antigens with potential utility throughout the monitoring and surveillance of schistosomiasis in the direction of the elimination of schistosomiasis.
aabioetica
aabioetica

Osteocalcin (BGLAP) Antibody

abx411101-02mg 0.2 mg
EUR 592.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411102-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411103-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411104-02mg 0.2 mg
EUR 565.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411105-02mg 0.2 mg
EUR 592.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411529-025ml 0.25 ml
EUR 704.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411530-1ml 1 ml
EUR 439.00
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody

abx411531-01ml 0.1 ml
EUR 439.00
  • Shipped within 1 week.

Mouse Osteocalcin (Bglap)

1-CSB-EP002682MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 21.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Osteocalcin(Bglap) expressed in E.coli

Rat Osteocalcin (BGLAP) ELISA Kit

abx574601-96tests 96 tests
EUR 715.00
  • Shipped within 5-12 working days.

Rat Osteocalcin (BGLAP) ELISA Kit

20-abx155931
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Rat Osteocalcin (BGLAP) ELISA Kit

abx051840-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Rat Osteocalcin (BGLAP) ELISA Kit

abx255867-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Rat Bglap/ Osteocalcin ELISA Kit

E0125Ra 1 Kit
EUR 571.00

Anti-Osteocalcin/BGLAP Antibody

PB9918 100ug/vial
EUR 334.00

Anti-Osteocalcin/BGLAP Antibody

PB9919 100ug/vial
EUR 334.00

Anti-Osteocalcin/BGLAP Antibody

PB9920 100ug/vial
EUR 334.00

Anti-Osteocalcin/BGLAP Antibody

PB9088 100ug/vial
EUR 334.00

Rat Osteocalcin / OC (BGLAP) CLIA Kit

abx195249-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Rat Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491526
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Human Osteocalcin (BGLAP) ELISA Kit

20-abx585064
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Cow Osteocalcin (BGLAP) ELISA Kit

abx572098-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Pig Osteocalcin (BGLAP) ELISA Kit

abx573472-96tests 96 tests
EUR 895.00
  • Shipped within 5-12 working days.

Chicken Osteocalcin (BGLAP) ELISA Kit

abx574068-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Dog Osteocalcin (BGLAP) ELISA Kit

abx575962-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Human Osteocalcin (BGLAP) ELISA Kit

abx576004-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Mouse Osteocalcin (BGLAP) ELISA Kit

abx576005-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Human BGLAP/ Osteocalcin ELISA Kit

E0272Hu 1 Kit
EUR 571.00

Mouse Osteocalcin (BGLAP) ELISA Kit

20-abx154491
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Pig Osteocalcin (BGLAP) ELISA Kit

20-abx154987
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Rabbit Osteocalcin (BGLAP) ELISA Kit

20-abx155095
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Chicken Osteocalcin (BGLAP) ELISA Kit

20-abx150050
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Cow Osteocalcin (BGLAP) ELISA Kit

20-abx150176
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Dog Osteocalcin (BGLAP) ELISA Kit

20-abx150283
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Human Osteocalcin (BGLAP) ELISA Kit

20-abx152600
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Pig Osteocalcin (BGLAP) ELISA Kit

abx051841-96tests 96 tests
EUR 754.00
  • Shipped within 5-10 working days.

Monkey Osteocalcin (BGLAP) ELISA Kit

abx353384-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

Rabbit Osteocalcin (BGLAP) ELISA Kit

abx257054-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

Human Osteocalcin (BGLAP) ELISA Kit

abx252856-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Mouse Osteocalcin (BGLAP) ELISA Kit

abx254305-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Goat Osteocalcin(BGLAP) ELISA kit

CSB-EL002682GO-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Goat Osteocalcin (BGLAP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Goat Osteocalcin(BGLAP) ELISA kit

1-CSB-EL002682GO
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Goat Osteocalcin(BGLAP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monkey Osteocalcin(BGLAP) ELISA kit

CSB-EL002682RH-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Monkey Osteocalcin (BGLAP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Monkey Osteocalcin(BGLAP) ELISA kit

1-CSB-EL002682RH
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Monkey Osteocalcin(BGLAP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chicken BGLAP/ Osteocalcin ELISA Kit

E0006Ch 1 Kit
EUR 717.00

Dog BGLAP/ Osteocalcin ELISA Kit

E0012Do 1 Kit
EUR 717.00

Pig BGLAP/ Osteocalcin ELISA Kit

E0024Pi 1 Kit
EUR 717.00

Bovine BGLAP/ Osteocalcin ELISA Kit

E0036Bo 1 Kit
EUR 717.00

Mouse Bglap/ Osteocalcin ELISA Kit

E0176Mo 1 Kit
EUR 571.00

Human Osteocalcin / OC (BGLAP) CLIA Kit

abx195247-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Mouse Osteocalcin / OC (BGLAP) CLIA Kit

abx195248-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Cow Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491520
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Dog Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491521
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

Chicken Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491522
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Human Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491523
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

Mouse Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491524
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

Pig Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491525
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Rabbit Osteocalcin / OC (BGLAP) CLIA Kit

20-abx491527
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Guinea pig Osteocalcin (BGLAP) ELISA Kit

abx250129-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

BGLAP Recombinant Protein (Rat)

RP192146 100 ug Ask for price

Sheep Osteocalcin/Bone Gla Protein (BGLAP) ELISA Kit

abx364174-96tests 96 tests
EUR 926.00
  • Shipped within 5-12 working days.

Mouse Osteocalcin- related protein, Bglap-rs1 ELISA KIT

ELI-12439m 96 Tests
EUR 865.00

BGLAP Recombinant Protein (Human)

RP036994 100 ug Ask for price

BGLAP Recombinant Protein (Mouse)

RP119513 100 ug Ask for price

BGLAP Recombinant Protein (Mouse)

RP119516 100 ug Ask for price

Recombinant Osteocalcin (OC)

4-RPA471Ga01
  • EUR 537.25
  • EUR 247.00
  • EUR 1739.68
  • EUR 646.56
  • EUR 1193.12
  • EUR 422.00
  • EUR 4199.20
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P02822
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 12.4KDa
  • Isoelectric Point: Inquire
Description: Recombinant Chicken Osteocalcin expressed in: E.coli

Recombinant Osteocalcin (OC)

4-RPA471Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P02818
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.9kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Osteocalcin expressed in: E.coli

Recombinant Osteocalcin (OC)

4-RPA471Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P86546
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Osteocalcin expressed in: E.coli

Recombinant Osteocalcin (OC)

4-RPA471Po01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.6kDa
  • Isoelectric Point: 4.5
Description: Recombinant Pig Recombinant Osteocalcin (OC) expressed in: E.coli

Recombinant Osteocalcin (OC)

4-RPA471Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P04640
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.7kDa
  • Isoelectric Point: 6.2
Description: Recombinant Rat Osteocalcin expressed in: E.coli

Recombinant Osteocalcin (OC)

4-RPA471Rb01
  • EUR 539.04
  • EUR 247.00
  • EUR 1746.40
  • EUR 648.80
  • EUR 1197.60
  • EUR 424.00
  • EUR 4216.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: G1TTE8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rabbit Osteocalcin expressed in: E.coli

Rat BGLAP shRNA Plasmid

20-abx984902
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat BGLAP ELISA Kit

STJ150184 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OC/BGP in Rat serum, plasma and other biological fluids

Osteocalcin (Osteocalcin) Antibody

20-abx110064
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

20-abx121305
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

20-abx001288
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx037757-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

20-abx006326
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx031339-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx031339-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx027978-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx027978-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx028306-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx028306-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

20-abx319643
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody

abx433081-200ul 200 ul
EUR 286.00
  • Shipped within 1-3 working days.

Osteocalcin (Osteocalcin) Antibody

abx236030-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Osteocalcin (Osteocalcin) Antibody

abx236031-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

PMF1-BGLAP Human Recombinant Protein

PROTU3KQ54 Regular: 20ug
EUR 317.00
Description: PMF1-BGLAP Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 234 amino acids (1-211aa) and having a molecular mass of 26.2kDa.

PMF1-BGLAP Recombinant Protein (Human)

RP083973 100 ug Ask for price

Bglap-rs1 Recombinant Protein (Mouse)

RP119519 100 ug Ask for price

BGLAP siRNA

20-abx900629
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BGLAP siRNA

20-abx909076
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BGLAP siRNA

20-abx909077
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BGLAP Antibody

36774-100ul 100ul
EUR 252.00

BGLAP Antibody

1-CSB-PA944463
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

Bglap Antibody

1-CSB-PA002682DA01RA
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Bglap. Recognizes Bglap from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

BGLAP Antibody

1-CSB-PA434737
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

BGLAP Antibody

1-CSB-PA277795
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

BGLAP Antibody

1-CSB-PA135204
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

BGLAP Antibody

1-CSB-PA11834A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Osteocalcin (Osteocalcin) Antibody Pair

abx117541-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010.00
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody (HRP)

20-abx108578
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody (Biotin)

20-abx105740
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody (FITC)

20-abx107158
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody (HRP)

20-abx319644
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody (FITC)

20-abx319645
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin (Osteocalcin) Antibody (Biotin)

20-abx319646
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Osteocalcin

MO15128 100 ul
EUR 435.00

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138.00

Bglap ORF Vector (Rat) (pORF)

ORF064050 1.0 ug DNA
EUR 506.00

Recombinant Rat Osteocalcin Protein, GST, E.coli-100ug

QP5717-ec-100ug 100ug
EUR 571.00

Recombinant Rat Osteocalcin Protein, GST, E.coli-10ug

QP5717-ec-10ug 10ug
EUR 272.00

Recombinant Rat Osteocalcin Protein, GST, E.coli-1mg

QP5717-ec-1mg 1mg
EUR 2303.00

Recombinant Rat Osteocalcin Protein, GST, E.coli-200ug

QP5717-ec-200ug 200ug
EUR 898.00

Recombinant Rat Osteocalcin Protein, GST, E.coli-500ug

QP5717-ec-500ug 500ug
EUR 1514.00

Recombinant Rat Osteocalcin Protein, GST, E.coli-50ug

QP5717-ec-50ug 50ug
EUR 362.00

Rat Osteocalcin ELISA kit

E02O0001-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteocalcin ELISA kit

E02O0001-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteocalcin ELISA kit

E02O0001-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Osteocalcin (Rat) ELISA Kit

E4764-100
EUR 620.00

Rat Osteocalcin (OC) Protein

20-abx068398
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

BGLAP Conjugated Antibody

C36774 100ul
EUR 397.00

BGLAP-RS1 siRNA

20-abx909075
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BGLAP cloning plasmid

CSB-CL002682HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 303
  • Sequence: ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAGC
  • Show more
Description: A cloning plasmid for the BGLAP gene.

PMF1-BGLAP Protein

20-abx261202
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

BGLAP Rabbit pAb

A6205-100ul 100 ul
EUR 308.00

BGLAP Rabbit pAb

A6205-200ul 200 ul
EUR 459.00

BGLAP Rabbit pAb

A6205-20ul 20 ul
EUR 183.00

BGLAP Rabbit pAb

A6205-50ul 50 ul
EUR 223.00

Bglap Polyclonal Antibody

A57033 100 µg
EUR 570.55
Description: reagents widely cited

BGLAP Polyclonal Antibody

A52249 100 µg
EUR 570.55
Description: reagents widely cited

BGLAP Rabbit pAb

A18241-100ul 100 ul
EUR 308.00

BGLAP Rabbit pAb

A18241-200ul 200 ul
EUR 459.00

BGLAP Rabbit pAb

A18241-20ul 20 ul
EUR 183.00

BGLAP Rabbit pAb

A18241-50ul 50 ul
EUR 223.00

BGLAP Rabbit pAb

A1530-100ul 100 ul
EUR 308.00

BGLAP Rabbit pAb

A1530-200ul 200 ul
EUR 459.00

BGLAP Rabbit pAb

A1530-20ul 20 ul Ask for price

BGLAP Rabbit pAb

A1530-50ul 50 ul Ask for price

BGLAP Rabbit pAb

A14636-100ul 100 ul
EUR 308.00

BGLAP Rabbit pAb

A14636-200ul 200 ul
EUR 459.00

BGLAP Rabbit pAb

A14636-20ul 20 ul
EUR 183.00

BGLAP Rabbit pAb

A14636-50ul 50 ul
EUR 223.00

Anti-BGLAP Antibody

STJ502017 100 µg
EUR 476.00

Anti-BGLAP antibody

STJ27961 100 µl
EUR 277.00
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Anti-BGLAP antibody

STJ11100198 100 µl
EUR 277.00
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Anti-BGLAP antibody

STJ22794 100 µl
EUR 277.00
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Anti-BGLAP antibody

STJ116843 100 µl
EUR 277.00
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Bglap sgRNA CRISPR Lentivector set (Rat)

K6905601 3 x 1.0 ug
EUR 339.00

Osteocalcin Antibody

abx024044-1mg 1 mg
EUR 1052.00
  • Shipped within 5-10 working days.

Osteocalcin Antibody

abx024045-1mg 1 mg
EUR 1052.00
  • Shipped within 5-10 working days.

Osteocalcin Antibody

ABF9248 100 ug
EUR 438.00

Osteocalcin Antibody

39376-100ul 100ul
EUR 390.00

Osteocalcin antibody

10-2408 250 ug
EUR 349.00
Description: Mouse Monoclonal Osteocalcin antibody

Osteocalcin antibody

10-2409 250 ug
EUR 403.00
Description: Mouse Monoclonal Osteocalcin antibody

Osteocalcin antibody

10-2410 250 ug
EUR 349.00
Description: Mouse Monoclonal Osteocalcin antibody

Osteocalcin antibody

10-2593 1 mg
EUR 738.00
Description: Mouse monoclonal Osteocalcin antibody

Osteocalcin antibody

10-7939 500 ug
EUR 543.00
Description: Mouse monoclonal Osteocalcin antibody

Osteocalcin antibody

10-7940 1 mg
EUR 738.00
Description: Mouse monoclonal Osteocalcin antibody

Osteocalcin protein

30C-CP3015U 20 ug
EUR 1429.00
Description: Purified native Human Osteocalcin protein

Osteocalcin protein

30R-3286 100 ug
EUR 278.00
Description: Purified recombinant Osteocalcin protein

Osteocalcin antibody

61-1056 250 ug
EUR 381.00
Description: Mouse Monoclonal Osteocalcin antibody (Biotin)

Osteocalcin antibody

70R-15261 100 ug
EUR 349.00
Description: Rabbit polyclonal Osteocalcin antibody

Osteocalcin Antibody

DF12303 200ul
EUR 304.00
Description: Osteocalcin antibody detects endogenous levels of Osteocalcin.

anti-Osteocalcin

YF-PA10471 50 ul
EUR 363.00
Description: Mouse polyclonal to Osteocalcin

anti-Osteocalcin

YF-PA10472 50 ug
EUR 363.00
Description: Mouse polyclonal to Osteocalcin

anti-Osteocalcin

YF-PA23299 50 ul
EUR 334.00
Description: Mouse polyclonal to Osteocalcin

Rat Carboxylated Osteocalcin ELISA kit

E02C0242-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylated Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylated Osteocalcin ELISA kit

E02C0242-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylated Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylated Osteocalcin ELISA kit

E02C0242-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylated Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Undercarboxylated Osteocalcin ELISA kit

E02U0008-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Undercarboxylated Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Undercarboxylated Osteocalcin ELISA kit

E02U0008-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Undercarboxylated Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Undercarboxylated Osteocalcin ELISA kit

E02U0008-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Undercarboxylated Osteocalcin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Osteocalcin (OC) ELISA Kit

DLR-OC-Ra-48T 48T
EUR 508.00
  • Should the Rat Osteocalcin (OC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Osteocalcin (OC) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Osteocalcin (OC) ELISA Kit

DLR-OC-Ra-96T 96T
EUR 661.00
  • Should the Rat Osteocalcin (OC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Osteocalcin (OC) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Osteocalcin (OC) Polyclonal Antibody (Rat)

4-PAA471Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: OC (Ala11~Thr98)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Osteocalcin (OC)

Rat Osteocalcin (OC) ELISA Kit

SEA471Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocalcin (OC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocalcin (OC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Osteocalcin (OC) ELISA Kit

SEA471Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocalcin (OC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocalcin (OC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Osteocalcin (OC) ELISA Kit

SEA471Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocalcin (OC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocalcin (OC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Osteocalcin (OC) ELISA Kit

SEA471Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Osteocalcin (OC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Osteocalcin (OC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Osteocalcin (OC) ELISA Kit

4-SEA471Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 0
  • 1
  • 2
  • Known also as Osteocalcin elisa. Alternative names of the recognized antigen: BGLAP
  • OT
  • BGP
  • Bone Gla Protein
  • Bone Gamma-Carboxyglutamate Protein
  • Gamma-carboxyglutamic acid-containing protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Osteocalcin (OC) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Osteocalcin ELISA Kit (OC)

RK03858 96 Tests
EUR 521.00

Rat Osteocalcin (OC) ELISA Kit

RD-OC-Ra-48Tests 48 Tests
EUR 511.00

Rat Osteocalcin (OC) ELISA Kit

RD-OC-Ra-96Tests 96 Tests
EUR 709.00

Rat Osteocalcin (OC) ELISA Kit

RDR-OC-Ra-48Tests 48 Tests
EUR 534.00

Knockout of the caspase Eight associated protein 2 gene improves recombinantprotein expression in HEK293 cells by the use of up-regulation of the cyclin-dependent kinase inhibitor 2A gene

Cell strains utilized in bioproduction are routinely engineered to boost their manufacturing effectivity. Fairly just a few strategies, corresponding to random mutagenesis, RNA interference screens, and transcriptome analyses have been employed to ascertain environment friendly engineering targets.

  • A genome-wide siRNA show display screen beforehand acknowledged the CASP8AP2 gene as a potential engineering aim for improved expression of recombinant protein throughout the HEK293 cell line. Proper right here, we validate the CASP8AP2 gene as an engineering aim in HEK293 cells by knocking it out using CRISPR/Cas9 genome modifying and assessing the influence of its knockout on recombinant protein expression, cell growth, cell viability, and whole gene expression. HEK293 cells lacking CASP8AP2 confirmed a 7-fold enhance particularly expression of recombinant luciferase and a 2.5-fold enhance particularly expression of recombinant SEAP, with out significantly affecting cell progress and viability.
  • Transcriptome analysis revealed that de-regulation of the cell cycle, significantly the upregulation of the cyclin dependent kinase inhibitor 2A (CDKN2A) gene, contributed to the advance in recombinant protein expression in CASP8AP2 poor cells. The outcomes validate the CASP8AP2 gene is a viable engineering aim for improved recombinant protein expression throughout the HEK293 cell line. This textual content is protected by copyright. All rights reserved.

Enchancment of a constitutive and an auto-inducible high-yield expression system for recombinantprotein manufacturing throughout the microalga Nannochloropsis oceanica

Photoautotrophic microalgae provide an superior potential as novel hosts for atmosphere pleasant recombinant protein manufacturing. Nannochloropsis oceanica produces an awfully extreme content material materials of polyunsaturated fatty acids, and its sturdy progress traits, revealed genome sequence and atmosphere pleasant nuclear transformation make N. oceanica a promising candidate for biotechnological functions.

To find out a sturdy and versatile system for recombinant protein manufacturing, we cloned six endogenous, doubtlessly constitutive or inducible promoters from N. oceanica stress CCMP1779 and investigated their vitality using monomeric Venus as reporter gene.

Microscopic pre-screening of explicit particular person transformants revealed that the promoters of elongation problem (EF), tubulin (TUB) and nitrate reductase (NR) enabled extreme reporter gene expression. Comparative quantitative analyses of transformant populations by stream cytometry and qRT-PCR demonstrated the perfect Venus expression from the EF promoter and the NR promoter if extended by an N-terminal 14-amino acid chief sequence.

  • The kinetics of reporter gene expression had been analysed all through photobioreactor cultivation, attaining Venus yields of 0.3% (for EF) and 4.9% (for NR::LS) of full soluble protein. Since inducible expression applications permit the manufacturing of toxic proteins, we developed an auto-induction medium for the NR promoter transformants.
  • By switching the N provide from ammonium to nitrate in the presence of low ammonium concentrations, the place to start of Venus induction may probably be fine-tuned and shifted within the course of exponential progress half whereas sustaining extreme recombinant protein yields.
  • Taken collectively, we reveal {{that a}} model recombinant protein could possibly be produced robustly and at very extreme ranges in N. oceanica not solely beneath constitutive however as well as beneath auto-inducible cultivation conditions.
  • KEY POINTS:

    • Nannochloropsis oceanica might operate host for recombinant protein manufacturing.

    • Comparative promoter vitality analyses had been carried out for twelve completely completely different constructs.

    • Sturdy high-yield recombinant protein manufacturing was achieved beneath constitutive conditions.

    • The nitrate reductase promoter enabled protein manufacturing beneath auto-induction conditions.

Rabbit Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Rb-96Tests 96 Tests
EUR 709.00

Rabbit Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Rb-48Tests 48 Tests
EUR 534.00

Rabbit Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Rb-96Tests 96 Tests
EUR 742.00

Rabbit Apolipoprotein E (APOE)

1-CSB-EP001936RB
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rabbit Apolipoprotein E(APOE),partial expressed in E.coli

Rabbit Apolipoprotein E (APOE)

1-CSB-EP001936RBb3
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 53.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rabbit Apolipoprotein E(APOE),partial expressed in E.coli

Rabbit Apolipoprotein E (APOE)

1-CSB-EP001936RBb7
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 50.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rabbit Apolipoprotein E(APOE),partial expressed in E.coli

Human Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Hu-48T 48T
EUR 441.00
  • Should the Human Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Hu-96T 96T
EUR 570.00
  • Should the Human Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Mu-48T 48T
EUR 489.00
  • Should the Mouse Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Mu-96T 96T
EUR 635.00
  • Should the Mouse Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-p-48T 48T
EUR 547.00
  • Should the Porcine Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-p-96T 96T
EUR 715.00
  • Should the Porcine Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein E (APOE) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Ra-48T 48T
EUR 508.00
  • Should the Rat Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein E (APOE) ELISA Kit

DLR-APOE-Ra-96T 96T
EUR 661.00
  • Should the Rat Apolipoprotein E (APOE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein E (APOE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Hu-48Tests 48 Tests
EUR 436.00

Human Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Hu-96Tests 96 Tests
EUR 601.00

Mouse Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Mu-48Tests 48 Tests
EUR 489.00

Mouse Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Mu-96Tests 96 Tests
EUR 677.00

Porcine Apolipoprotein E (APOE) ELISA Kit

RD-APOE-p-48Tests 48 Tests
EUR 555.00

Porcine Apolipoprotein E (APOE) ELISA Kit

RD-APOE-p-96Tests 96 Tests
EUR 771.00

Rat Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Ra-48Tests 48 Tests
EUR 511.00

Rat Apolipoprotein E (APOE) ELISA Kit

RD-APOE-Ra-96Tests 96 Tests
EUR 709.00

Human Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Hu-48Tests 48 Tests
EUR 455.00

Human Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Hu-96Tests 96 Tests
EUR 629.00

Mouse Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Mu-48Tests 48 Tests
EUR 511.00

Mouse Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Mu-96Tests 96 Tests
EUR 709.00

Porcine Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-p-48Tests 48 Tests
EUR 580.00

Porcine Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-p-96Tests 96 Tests
EUR 807.00

Rat Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Ra-48Tests 48 Tests
EUR 534.00

Rat Apolipoprotein E (APOE) ELISA Kit

RDR-APOE-Ra-96Tests 96 Tests
EUR 742.00

Recombinant Apolipoprotein E (APOE)

4-RPA704Ca01
  • EUR 556.96
  • EUR 252.00
  • EUR 1813.60
  • EUR 671.20
  • EUR 1242.40
  • EUR 436.00
  • EUR 4384.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P18649
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Apolipoprotein E expressed in: E.coli

Recombinant Apolipoprotein E (APOE)

4-RPA704Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P02649
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.0kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Apolipoprotein E expressed in: E.coli

Recombinant Apolipoprotein E (APOE)

4-RPA704Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P08226
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.0kDa
  • Isoelectric Point: 5.7
Description: Recombinant Mouse Apolipoprotein E expressed in: E.coli

Recombinant Apolipoprotein E (APOE)

4-RPA704Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P02650
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.6kDa
  • Isoelectric Point: 5.8
Description: Recombinant Rat Apolipoprotein E expressed in: E.coli

ELISA kit for Rabbit ApoE (Apolipoprotein E)

E-EL-RB1510 1 plate of 96 wells
EUR 584.00
  • Gentaur's ApoE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ApoE. Standards or samples are added to the micro ELISA plate wells and combined with t
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rabbit ApoE (Apolipoprotein E) in samples from Serum, Plasma, Cell supernatant

Rabbit Apolipoprotein E (APOE) Protein

20-abx652556
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Apolipoprotein E/ApoE

E21-I02 10ug
EUR 343.00

Apolipoprotein E/Apo-E/APOE

E21-J05 10ug
EUR 343.00

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

CEA704Rb-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rabbit Apolipoprotein E (APOE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rabbit Apolipoprotein E (APOE) in serum, plasma and other biological fluids.

Rabbit Apolipoprotein E (APOE) ELISA Kit

4-CEA704Rb
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 0
  • 1
  • 2
  • Known also as Apolipoprotein E elisa. Alternative names of the recognized antigen: Apo-E
  • AD2
  • Apoprotein
  • Alzheimer Disease 2(E4-Associated, Late Onset
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rabbit Apolipoprotein E (APOE) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rabbit Apolipoprotein E, APOE ELISA KIT

ELI-02454Ra 96 Tests
EUR 928.00

Rabbit ApoE(Apolipoprotein E) ELISA Kit

ERB0014 96T
EUR 567.60
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P18287
  • Alias: APO-E(Apolipoprotein E)/Apo-E/MGC1571/apolipoprotein E3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 0.375 ng/ml

Rabbit Apolipoprotein E (APOE) ELISA Kit

20-abx155039
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Rabbit Apolipoprotein E (APOE) ELISA Kit

abx052466-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Rabbit Apolipoprotein E (APOE) CLIA Kit

20-abx490213
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Rabbit Apolipoprotein E (APOE) ELISA Kit

abx256979-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Apolipoprotein E (APOE) Antibody

20-abx109551
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

20-abx171281
  • EUR 718.00
  • EUR 384.00
  • 0
  • 1
  • Please enquire.

Apolipoprotein E (APOE) Antibody

20-abx171282
  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Apolipoprotein E (APOE) Antibody

20-abx171283
  • EUR 843.00
  • EUR 439.00
  • 0
  • 1
  • Please enquire.

Apolipoprotein E (APOE) Antibody

20-abx171284
  • EUR 871.00
  • EUR 453.00
  • 0
  • 1
  • Please enquire.

Apolipoprotein E (APOE) Antibody

20-abx171285
  • EUR 913.00
  • EUR 467.00
  • 0
  • 1
  • Please enquire.

Apolipoprotein E (APOE) Antibody

20-abx132168
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Apolipoprotein E (APOE) Antibody

20-abx101447
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Apolipoprotein E (APOE) Antibody

20-abx101448
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Apolipoprotein E (APOE) Antibody

20-abx101449
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Apolipoprotein E (APOE) Antibody

20-abx104920
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Apolipoprotein E (APOE) Antibody

abx033494-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

abx033494-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

20-abx009578
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

20-abx009579
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Apolipoprotein E (ApoE) Antibody

abx010563-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Apolipoprotein E (ApoE) Antibody

20-abx007195
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

20-abx015177
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Apolipoprotein E (ApoE) Antibody

abx019017-100ug 100 ug
EUR 342.00
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

20-abx175439
  • EUR 1135.00
  • EUR 551.00
  • 0
  • 1
  • Please enquire.

Apolipoprotein E (APOE) Antibody

20-abx323324
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

20-abx328373
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

abx330705-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Apolipoprotein E (APOE) Antibody

abx432347-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Apolipoprotein E (APOE) Antibody

20-abx301032
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Mouse Apolipoprotein E (Apoe)

1-CSB-YP001936MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 36 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Apolipoprotein E(Apoe) expressed in Yeast

Mouse Apolipoprotein E (Apoe)

1-CSB-EP001936MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 38 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Apolipoprotein E(Apoe) expressed in E.coli

ELISA kit for Mouse ApoE (Apolipoprotein E)

E-EL-M0135 1 plate of 96 wells
EUR 377.00
  • Gentaur's ApoE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ApoE. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ApoE (Apolipoprotein E) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human ApoE (Apolipoprotein E)

E-CL-H0383 1 plate of 96 wells
EUR 584.00
  • Gentaur's ApoE CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ApoE . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ApoE (Apolipoprotein E) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ApoE (Apolipoprotein E)

E-EL-R1230 1 plate of 96 wells
EUR 377.00
  • Gentaur's ApoE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ApoE. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ApoE (Apolipoprotein E) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Rat ApoE (Apolipoprotein E)

E-CL-R0718 1 plate of 96 wells
EUR 584.00
  • Gentaur's ApoE CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat ApoE . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat ApoE (Apolipoprotein E) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ApoE (Apolipoprotein E)

E-EL-H0470 1 plate of 96 wells
EUR 377.00
  • Gentaur's ApoE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ApoE. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ApoE (Apolipoprotein E) in samples from Serum, Plasma, Cell supernatant

Recombinant Human Apolipoprotein E/ApoE Protein

RP00306 10 μg
EUR 109.00

ELISA kit for Rabbit APOE (Apolipoprotein E)

ELK2024 1 plate of 96 wells
EUR 526.00
  • A monoclonal antibody specific to Apolipoprotein E (APOE) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Apolipoprotein E (APOE) and unlabeled Apolipoprotein E (APOE) (Standards or samples)
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Apolipoprotein E from Rabbit in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pig Apolipoprotein E (APOE) Protein

20-abx652555
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Mouse Apolipoprotein E (APOE) Protein

20-abx065426
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Rat Apolipoprotein E (APOE) Protein

20-abx065427
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Human Apolipoprotein E (APOE) Protein

20-abx065429
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Dog Apolipoprotein E (APOE) Protein

20-abx168028
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Apolipoprotein E (APOE) Antibody (Biotin)

20-abx105158
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00