Recombinant transgelin-like protein 1


Recombinant KRAS G12D Protein Vaccines Elicit Vital Anti-Tumor Ends in Mouse CT26 Tumor Fashions

Drug progress concentrating on most likely probably the most constantly mutation G12D of KRAS has good significance. As a beautiful immunotherapy, most cancers vaccines can overcome binding difficulties of small molecules; nonetheless, the weak immunogenicity and manufacturing difficulties of reported KRAS mutation vaccines prohibit their scientific utility.

  • To reinforce antigen-specific immune responses and Anti-Tumor outcomes on tumors expressing KRAS G12D mutation, we designed recombinant proteins containing KRAS peptide (amino acids 5-21) with G12D (known as SP) in two varieties: DTT-SP4 and DTSP. DTT-SP4 was constructed by fusing Four copies of SP to the C-terminal of the translocation space of diphtheria toxin (DTT), and DTSP was constructed by grafting SP onto DTT.
  • The two vaccines along with aluminum hydroxide (Alum) and cytosine phosphoguanine (CpG) effectively induced conspicuous SP-specific humoral and cellular immune responses, and displayed excellent defending and therapeutic Anti-Tumor ends in mouse CT26 tumor fashions.
  • Surprisingly, the DTSP-treated group displayed increased Anti-Tumor outcomes in vivo in distinction with the DTT-SP4-treated and administration groups.
  • Moreover, 87.5 and 50% of DTSP-treated mice throughout the preventive and therapeutic fashions had been tumor free, respectively. Notably, throughout the DTSP-treated group, the interferon-γ (IFN-γ) expression of T cells in vitro and the T-helper 1 (Th1)-related cytokine expression in tumor tissues indicated that the activated Th1 immune response is also involved in Anti-Tumor train.
  • Furthermore, DTSP treatment remarkably altered the subpopulation of T cells in splenocytes and tumor-infiltrating lymphocytes. The share of effector CD8+ T cells elevated, whereas that of immunosuppressive CD4+Foxp3+ T cells remained diminished throughout the DTSP group. Dramatic tumor-inhibitory outcomes of DTSP, which is properly prepared, make it a further engaging method in the direction of KRAS G12D tumors.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Mu-96T 96T
EUR 635
  • Should the Mouse Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Mu-48Tests 48 Tests
EUR 489

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Mu-96Tests 96 Tests
EUR 677

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Mu-48Tests 48 Tests
EUR 511

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Mu-96Tests 96 Tests
EUR 709

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-b-48T 48T
EUR 547
  • Should the Bovine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-b-96T 96T
EUR 715
  • Should the Bovine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Canine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-c-48T 48T
EUR 527
  • Should the Canine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Canine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-c-96T 96T
EUR 688
  • Should the Canine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Alpha-Fetoprotein (aFP) in samples from serum, plasma or other biological fluids.

Equine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Eq-48T 48T
EUR 556
  • Should the Equine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Equine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Eq-96T 96T
EUR 728
  • Should the Equine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Equine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Hu-48T 48T
EUR 366
  • Should the Human Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Hu-96T 96T
EUR 465
  • Should the Human Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-p-48T 48T
EUR 547
  • Should the Porcine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-p-96T 96T
EUR 715
  • Should the Porcine Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Ra-48T 48T
EUR 508
  • Should the Rat Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Ra-96T 96T
EUR 661
  • Should the Rat Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Si-48T 48T
EUR 576
  • Should the Monkey Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

DLR-aFP-Si-96T 96T
EUR 755
  • Should the Monkey Alpha-Fetoprotein (aFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Alpha-Fetoprotein (aFP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-b-48Tests 48 Tests
EUR 555

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-b-96Tests 96 Tests
EUR 771

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-c-48Tests 48 Tests
EUR 533

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-c-96Tests 96 Tests
EUR 740

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Eq-48Tests 48 Tests
EUR 566

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Eq-96Tests 96 Tests
EUR 787

Human Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Hu-48Tests 48 Tests
EUR 350

Human Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Hu-96Tests 96 Tests
EUR 479

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-p-48Tests 48 Tests
EUR 555

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-p-96Tests 96 Tests
EUR 771

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Ra-48Tests 48 Tests
EUR 511

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Ra-96Tests 96 Tests
EUR 709

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Si-48Tests 48 Tests
EUR 587

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RD-aFP-Si-96Tests 96 Tests
EUR 818

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-b-48Tests 48 Tests
EUR 580

Bovine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-b-96Tests 96 Tests
EUR 807

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-c-48Tests 48 Tests
EUR 557

Canine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-c-96Tests 96 Tests
EUR 774

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Eq-48Tests 48 Tests
EUR 591

Equine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Eq-96Tests 96 Tests
EUR 823

Human Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Hu-48Tests 48 Tests
EUR 365

Human Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Hu-96Tests 96 Tests
EUR 500

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-p-48Tests 48 Tests
EUR 580

Porcine Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-p-96Tests 96 Tests
EUR 807

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Ra-48Tests 48 Tests
EUR 534

Rat Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Ra-96Tests 96 Tests
EUR 742

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Si-48Tests 48 Tests
EUR 614

Monkey Alpha-Fetoprotein (aFP) ELISA Kit

RDR-aFP-Si-96Tests 96 Tests
EUR 856

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3SZ57
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.6kDa
  • Isoelectric Point: 6
Description: Recombinant Bovine Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJU5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27435
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.5kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P27435
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 75.2kDa
  • Isoelectric Point: 5.5
Description: Recombinant Human Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02772
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.7kDa
  • Isoelectric Point: 5.7
Description: Recombinant Mouse Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.6kDa
  • Isoelectric Point: 5.8
Description: Recombinant Pig Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 46.1kDa
  • Isoelectric Point: 6
Description: Recombinant Pig Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8MJ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 52.9kDa
  • Isoelectric Point: 5.9
Description: Recombinant Pig Alpha-Fetoprotein expressed in: E.coli

Recombinant Alpha-Fetoprotein (aFP)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02773
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 49.7kDa
  • Isoelectric Point: 6.2
Description: Recombinant Rat Alpha-Fetoprotein expressed in: E.coli

Mouse Alpha-fetoprotein (Afp)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in E.coli

Mouse Alpha-fetoprotein (Afp)

  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in E.coli

Mouse Alpha-fetoprotein (Afp)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Alpha-fetoprotein(Afp) expressed in Yeast

Mouse Alpha-Fetoprotein (aFP) Protein

  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (AFP) Antibody

abx022523-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx022524-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025195-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025195-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx025196-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027957-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027957-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027958-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx027958-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx018327-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx019011-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020102-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020507-1mg 1 mg
EUR 662
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020508-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020509-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020510-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020512-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020513-1mg 1 mg
EUR 690
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020514-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020515-1mg 1 mg
EUR 739
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx020561-1mg 1 mg
EUR 481
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx015762-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 1316.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 1372.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx125411-50ul 50 ul
EUR 411
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

abx037404-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha Fetoprotein (AFP) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha Fetoprotein (AFP) Antibody

abx159321-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.

alpha-Fetoprotein (AFP) Antibody

abx139033-01mg 0.1 mg
EUR 328
  • Shipped within 5-12 working days.

alpha-Fetoprotein (AFP) Antibody

abx139034-01mg 0.1 mg
EUR 328
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha-Fetoprotein (aFP) Antibody

  • EUR 954.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.

Alpha Fetoprotein (AFP) Protein

abx061589-1mg 1 mg
EUR 829
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

alpha-Fetoprotein (AFP) Antibody

abx432318-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Alpha-Fetoprotein (AFP) Antibody

abx230203-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Alpha-Fetoprotein (AFP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) ELISA

EUR 664

AFP Alpha-Fetoprotein Human

PROTP02771 Regular: 50ug
EUR 317
Description: Human alpha-fetoprotein purified from human cord serum, shows a 70kDa band on SDS-PAGE.

AFP Alpha Fetoprotein Human Recombinant Protein

PROTP02771-1 Regular: 10ug
EUR 317
Description: AFP produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 597 amino acids (19-609a.a.) and having a molecular mass of 67.3kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa)._x000D_ _x000D_ AFP is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Recombinant Human AFP/Alpha-Fetoprotein Protein

RP00780 10 μg
EUR 183

Mouse Monoclonal Anti-human Alpha fetoprotein (AFP) (clone 1)

AFP11-M 1 mg
EUR 482

Mouse Monoclonal Anti-human Alpha fetoprotein (AFP) (clone 2)

AFP12-M 1 mg
EUR 482

Mouse Afp/ Alpha-fetoprotein ELISA Kit

E0050Mo 1 Kit
EUR 460

Mouse Alpha Fetoprotein (AFP) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Alpha-fetoprotein (AFP) ELISA Kit

abx254648-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Alpha-fetoprotein, AFP ELISA Kit

CSB-E08282m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Alpha-fetoprotein, AFP in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Alpha-fetoprotein, AFP ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Alpha-fetoprotein, AFP in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Alpha-fetoprotein,AFP ELISA Kit

CN-02749M1 96T
EUR 464

Mouse Alpha-fetoprotein,AFP ELISA Kit

CN-02749M2 48T
EUR 313

AFP/alpha 1 Fetoprotein Mouse mAb

BF9203 100 ug
EUR 438

Mouse Alpha Fetoprotein (AFP) ELISA Kit

abx570063-96tests 96 tests
EUR 613
  • Shipped within 5-12 working days.

Mouse Alpha-Fetoprotein (aFP) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Alpha-fetoprotein(AFP)ELISA Kit  

GA-E0562MS-48T 48T
EUR 336

Mouse Alpha-fetoprotein(AFP)ELISA Kit  

GA-E0562MS-96T 96T
EUR 534

Alpha-Fetoprotein (aFP) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: aFP (Lys399~Val605)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Alpha-Fetoprotein (aFP)

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

SEA153Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Alpha-Fetoprotein (aFP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Alpha-Fetoprotein (aFP) in serum, plasma and other biological fluids.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

SEA153Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Alpha-Fetoprotein (aFP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Alpha-Fetoprotein (aFP) in serum, plasma and other biological fluids.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

SEA153Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Alpha-Fetoprotein (aFP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Alpha-Fetoprotein (aFP) in serum, plasma and other biological fluids.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

SEA153Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Alpha-Fetoprotein (aFP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Alpha-Fetoprotein (aFP) in serum, plasma and other biological fluids.

Mouse Alpha-Fetoprotein (aFP) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Alpha-Fetoprotein elisa. Alternative names of the recognized antigen: A-FP
  • FETA
  • Alpha-Fetoglobulin
  • Alpha-1-fetoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Alpha-Fetoprotein (aFP) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Alpha-Fetoprotein ELISA Kit (aFP)

RK02576 96 Tests
EUR 521

Mouse Alpha-fetoprotein(AFP)ELISA Kit

QY-E20071 96T
EUR 361

Goat Anti-human Alpha fetoprotein (AFP) IgG, pure

AFP13-A 1 mg
EUR 651

Human alpha-Fetoprotein (AFP) Antibody

32221-05111 150 ug
EUR 261

Human Alpha-Fetoprotein (AFP) Antibody

12021-05011 150 ug
EUR 217

AFP (Alpha fetoprotein) ELISA test

6 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of AFP (Alpha fetoprotein)

Polyclonal AFP / Alpha Fetoprotein Antibody

APR02889G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AFP / Alpha Fetoprotein . This antibody is tested and proven to work in the following applications:

Alpha-fetoprotein, AFP (Capture) Antibody

abx019291-1mg 1 mg
EUR 523
  • Shipped within 5-10 working days.

Alpha-fetoprotein, AFP (Detection) Antibody

abx019292-1mg 1 mg
EUR 523
  • Shipped within 5-10 working days.

alpha Fetoprotein (AFP) Antibody (Biotin)

abx020506-1mg 1 mg
EUR 1107
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-Fetoprotein (AFP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant transgelin-like protein 1 from Mytilus shell induces formation of CaCO 3 polymorphic crystals in vitro

  • Transgelin is an actin cross-linking/gelling protein of the calponin family which is expounded to actin stress fibres, cell motility, adhesion, and the maintenance of cell morphology. Transgelin-like proteins (TLPs) have moreover been acknowledged as shell matrix proteins (SMPs) in a variety of mollusc species; nonetheless, the capabilities of TLPs in biomineralization keep Transgelin-like protein 1 (TLP-1) was beforehand acknowledged from the shell of Mytilus coruscus as a novel 19 kDa SMP with a calponin homology (CH) space. To know the place of TLP-1 in shell formation, the expression diploma and localization of the TLP-1 gene in biomineralization-related tissues had been selected this analysis.
  • Furthermore, recombinant TLP-1 was expressed in a prokaryotic expression system with codon optimization, and an anti-rTLP-1 antibody was prepared based totally on the expressed recombinant TLP-1 (rTLP-1) protein. In vitro, rTLP-1 induced the formation of CaCO3 polymorphic crystals with distinct morphologies and inhibited crystallization cost and crystal interactions. Immunohistochemical, immunofluorescence, and pull-down analyses using the anti-rTLP-1 antibody revealed the exact locations of TLP-1 in biomineralization-related tissues and shell myostracum layer, and steered the existence of a possible TLP-1 interaction neighborhood throughout the shell matrix. Our outcomes are helpful for understanding the capabilities of TLP-1, considerably by the use of its CH space, all through shell mineralization.

Downregulation of T7 RNA polymerase transcription enhances pET-based recombinantprotein manufacturing in Escherichia coli BL21 (DE3) by suppressing autolysis

  1. coli BL21 (DE3) is an excellent and extensively used host for recombinant protein manufacturing. Many variant hosts had been developed from BL21 (DE3), nevertheless bettering the expression of explicit proteins stays a major problem in biotechnology. On this analysis, we found that when BL21 (DE3) overexpressed glucose dehydrogenase (GDH), a significant industrial enzyme, excessive cell autolysis was induced. Subsequently, we observed this phenomenon throughout the expression of 10 completely different recombinant proteins.
  • This precludes a further enhance of the produced enzyme train by extending the fermentation time, which is not conducive to the low cost of enterprise enzyme manufacturing costs. Analysis of membrane development and mRNA expression analysis confirmed that cells might underwent a sort of programmed cell demise (PCD) all through the autolysis interval. Nonetheless, blocking three recognized PCD pathways in BL21 (DE3) did not absolutely alleviate autolysis absolutely.
  • Consequently, we tried to develop a robust expression host proof towards autolysis by controlling the rate of recombinant protein expression. To find a further applicable protein expression cost, the high- and low-strength promoter lacUV5 and lac had been shuffled and recombined to yield the promoter variants lacUV5-1A and lac-1G. The outcomes confirmed that only one base in lac promoter should be modified, and the A on the +1 place was modified to a G, ensuing throughout the improved host BL21 (DE3-lac1G), which proof towards autolysis.
  • As a consequence, the GDH train at 43h was vastly elevated from 37.5 to 452.Zero U/mL. In scale-up fermentation, the model new host was ready to provide the model enzyme with a extreme cost of 89.55 U/mL/h at 43h, compared with solely Three U/mL/h achieved using BL21 (DE3). Importantly, BL21 (DE3-lac1G) moreover effectively improved the manufacturing of 10 completely different enzymes.
  • The engineered E. coli stress constructed on this analysis conveniently optimizes recombinant protein overexpression by suppressing cell autolysis, and reveals good potential for industrial functions. This textual content is protected by copyright. All rights reserved.

Recombinant Sterol Carrier Protein 2 (SCP2)

  • EUR 433.31
  • EUR 219.00
  • EUR 1349.92
  • EUR 516.64
  • EUR 933.28
  • EUR 353.00
  • EUR 3224.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11915
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Sterol Carrier Protein 2 expressed in: E.coli

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx038200-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx034040-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx034040-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx026860-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx026860-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237652-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237653-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237654-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Sterol Carrier Protein 2 (SCP2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1692.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Sterol Carrier Protein 2 (SCP2) Protein

  • EUR 606.00
  • EUR 258.00
  • EUR 1831.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Sterol Carrier Protein 2 (SCP2) ELISA Kit

abx383064-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol carrier protein 2 Antibody

abx431575-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-Sterol carrier protein 2 antibody

STJ71576 100 µg
EUR 359

SCP2 sterol-binding domain containing 1 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2D1 SCP2 sterol-binding domain containing 1 Human Recombinant Protein

PROTQ9UJQ7 Regular: 10ug
EUR 317
Description: SCP2D1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.SCP2D1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Polyclonal Sterol carrier protein 2 Antibody (internal region)

APR10298G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Sterol carrier protein 2 (internal region). This antibody is tested and proven to work in the following applications:

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2 Recombinant Protein (Human)

RP027781 100 ug Ask for price

SCP2 Recombinant Protein (Human)

RP027784 100 ug Ask for price

SCP2 Recombinant Protein (Rat)

RP227723 100 ug Ask for price

SCP2 Recombinant Protein (Mouse)

RP170345 100 ug Ask for price

Recombinant purified (>98%) Human FAS Ligand Protein (carrier free)

FASL15-R-2 2 ug
EUR 347

Scp2/ Rat Scp2 ELISA Kit

ELI-44038r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCP2 antibody

70R-3015 50 ug
EUR 467
Description: Rabbit polyclonal SCP2 antibody raised against the middle region of SCP2

SCP2 Antibody

39403-100ul 100ul
EUR 390

SCP2 Antibody

43535-100ul 100ul
EUR 252


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SCP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SCP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SCP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


YF-PA14533 50 ug
EUR 363
Description: Mouse polyclonal to SCP2


YF-PA14534 100 ug
EUR 403
Description: Rabbit polyclonal to SCP2

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein

PROTP04090-2 25ug
EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Murine IL-2 Protein

PROTP04351-2 20ug
EUR 317
Description: IL-2 is a powerful immunoregulatory lymphokine produced by T-cells in response to antigenic or mitogenic stimulation. IL-2/IL-2R signaling is required for T-cell proliferation and other fundamental functions which are essential for the immune response. IL-2 stimulates growth and differentiation of B-cells, NK cells, lymphokine activated killer cells, monocytes, macrophages and oligodendrocytes. Recombinant murine IL-2 is a 17.2 kDa protein, containing 149 amino acid residues.

Recombinant Human PAI-2 Protein

PROTP05120-2 10ug
EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein

PROTP08253-2 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

Mouse FGF-2 Recombinant Protein

R00121-2 5ug/vial
EUR 259
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast.

Chicken IL-2 Recombinant Protein

R00387-2 5ug/vial
EUR 259
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Chicken IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

Recombinant Human TFF-2 Protein

PROTQ03403-2 20ug
EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer

PROTP12643-2 Regular: 20ug
EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

ErbB2 ErbB-2 Human Recombinant Protein

PROTP04626-2 Regular: 20ug
EUR 317
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

IL-2 Interleukin-2 Human Recombinant Protein, His Tag

PROTP60568-2 Regular: 10ug
EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

SCP2 Conjugated Antibody

C43535 100ul
EUR 397

SCP2 cloning plasmid

CSB-CL020856HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 432
  • Sequence: atgggttttccggaagccgccagttcttttagaactcatcaaattgaagctgttccaaccagctctgcaagtgatggatttaaggcaaatcttgtttttaaggagattgagaagaaacttgaagaggaaggggaacagtttgtgaagaaaatcggtggtatttttgccttcaaggt
  • Show more
Description: A cloning plasmid for the SCP2 gene.

SCP2 cloning plasmid

CSB-CL020856HU2-10ug 10ug