The Genome Analysis of the Human Lung-Associated Streptomyces sp. TR1341 Revealed the Presence of Beneficial Genes for Opportunistic Colonization of Human Tissues

Streptomyces sp. TR1341 was remoted from the sputum of a person with a historical past of lung and kidney tuberculosis, recurrent respiratory infections, and COPD. It produces secondary metabolites related to cytotoxicity and immune response modulation.
On this examine, we complement our earlier outcomes by figuring out the genetic options related to the manufacturing of those secondary metabolites and different traits that would profit the pressure throughout its colonization of human tissues (virulence elements, modification of the host immune response, or the manufacturing of siderophores).
We carried out a comparative phylogenetic evaluation to establish the genetic options which are shared by environmental isolates and human respiratory pathogens. The outcomes confirmed a excessive genomic similarity of Streptomyces sp.
TR1341 to the plant-associated Streptomyces sp. endophyte_N2, inferring a soil origin of the pressure. Putative virulence genes, similar to mammalian cell entry (mce) genes weren’t detected within the TR1341’s genome.
The presence of a kind VII secretion system, distinct from those present in Mycobacterium species, suggests a unique colonization technique than the one utilized by different actinomycete lung pathogens. We recognized the next range of genes associated to iron acquisition and demonstrated that the pressure produces ferrioxamine B in vitro. These outcomes point out that TR1341 might have a bonus in colonizing environments which are low in iron, similar to human tissue.
The Genome Analysis of the Human Lung-Associated Streptomyces sp. TR1341 Revealed the Presence of Beneficial Genes for Opportunistic Colonization of Human Tissues

In Vivo Lentiviral Gene Supply of HLA-DR and Vaccination of Humanized Mice for Enhancing the Human T and B Cell Immune Reconstitution

Humanized mouse fashions generated with human hematopoietic stem cells (HSCs) and reconstituting the human immune system (HIS-mice) are invigorating preclinical testing of vaccines and immunotherapies. We’ve lately proven that human engineered dendritic cells boosted bonafide human T and B cell maturation and antigen-specific responses in HIS-mice.
Right here, we evaluated a cell-free system based mostly on in vivo co-delivery of lentiviral vectors (LVs) for expression of a human leukocyte antigen (HLA-DRA*01/ HLA-DRB1*0401 practical advanced, “DR4”), and a LV vaccine expressing human cytokines (GM-CSF and IFN-α) and a human cytomegalovirus gB antigen (HCMV-gB).
Humanized NOD/Rag1null/IL2Rγnull (NRG) mice injected by i.v. with LV-DR4/fLuc confirmed long-lasting (as much as 20 weeks) vector distribution and expression within the spleen and liver. In vivo administration of the LV vaccine after LV-DR4/fLuc supply boosted the cellularity of lymph nodes, promoted maturation of terminal effector CD4+ T cells, and promoted considerably larger growth of IgG+ and IgA+ B cells. This modular lentigenic system opens a number of views for fundamental human immunology analysis and preclinical utilization of LVs to ship HLAs into HIS-mice.
The Genome Analysis of the Human Lung-Associated Streptomyces sp. TR1341 Revealed the Presence of Beneficial Genes for Opportunistic Colonization of Human Tissues

Impression of the Epigenetically Regulated Hoxa-5 Gene in Neural Differentiation from Human Adipose-Derived Stem Cells

Human adipose-derived mesenchymal stem cells (hASCs) could also be utilized in some nervous system pathologies, though acquiring an ample diploma of neuronal differentiation is a crucial barrier to their applicability. This requires a deep understanding of the expression and epigenetic adjustments of an important genes concerned of their differentiation.
We used hASCs from human lipoaspirates to induce neuronal-like cells by means of three protocols (Neu1, 2, and three), decided the diploma of neuronal differentiation utilizing particular biomarkers in tradition cells and neurospheres, and analyzed epigenetic adjustments of genes concerned on this differentiation.
Moreover, we chosen the Hoxa-5 gene to find out its potential to enhance neuronal differentiation. Our outcomes confirmed that a superb hASC neuronal differentiation course of utilizing Neu1 which effectively modulated NES, CHAT, SNAP25, or SCN9A neuronal marker expression.
As well as, epigenetic research confirmed related adjustments in Hoxa-5GRM4FGFR1RTEL1METRN, and PAX9 genes. Useful research of the Hoxa-5 gene utilizing CRISPR/dCas9 and lentiviral programs confirmed that its overexpression induced hASCs neuronal differentiation that was accelerated with the publicity to Neu1. These outcomes recommend that Hoxa-5 is an important gene in hASCs neuronal differentiation and due to this fact, a possible candidate for the event of cell remedy methods in neurological problems.

Revealing the distribution traits of antibiotic resistance genes and bacterial communities in animal-aerosol-human in a rooster farm: From One-Well being perspective

Antibiotics in breeding trade can enter the surroundings by means of a number of pathways, thus accelerating the emergence and unfold of antibiotic resistance genes (ARGs), amongst which aerosol transmission is well achieved and sometimes neglected.
To elucidate the position of aerosols on this scenario, the current examine investigated the distribution traits of 107 ARG subtypes (focusing on to eight completely different ARG varieties) and 9 cellular genetic components (MGEs) and bacterial neighborhood in animal (rooster cloaca), surroundings (aerosols) and human (nasopharynx) of a rooster farm (n = 42) in Henan Province. In complete, 116 ARG subtypes and MGEs have been recognized within the poultry farm.
The full bacterial focus of aerosols contained in the rooster home (3.117 × 104 CFU/m3) exceeded the corresponding restrict. The microbial communities within the samples of cloaca swab (C) and the employees’ nasopharyngeal swab (N) have been nearer, whereas the abundance distribution of ARGs/ MGEs in cloacal swab (C) and aerosol (AI) in rooster home have been a lot comparable.
There have been sure consistency of the microbial neighborhood construction and the distribution of ARGs among the many three teams of rooster cloaca, air aerosol, and employees’ nasopharynx. Our outcomes highlighted that animal breeding does have a sure impression on the encircling surroundings and human, and aerosols play an essential position on this course of.

Modulation of the Human Erythroid Plasma Membrane Calcium Pump (PMCA4b) Expression by Polymorphic Genetic Variants

Within the human ATP2B4 gene, coding for the plasma membrane calcium pump PMCA4b, a minor haplotype ends in the decreased expression of this membrane protein in erythroid cells. The presence of this haplotype and the consequently decreased PMCA4b expression have been recommended to have an effect on pink blood cell hydration and malaria susceptibility.
By utilizing dual-luciferase reporter assays, we have now localized the erythroid-specific regulatory area inside the haplotype of the ATP2B4 gene, containing predicted GATA1 binding websites which are affected by SNPs within the minor haplotype.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

abx029125-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

20-abx318666
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

abx237321-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody (HRP)

20-abx311381
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody (FITC)

20-abx311382
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody (Biotin)

20-abx311383
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rmi1 ELISA Kit| Mouse RecQ-mediated genome instability protein

EF015197 96 Tests
EUR 689

RMI1 ELISA Kit| Bovine RecQ-mediated genome instability protein

EF011502 96 Tests
EUR 689

Rat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E02R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E02R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E02R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse RecQ mediated genome instability protein 1(RMI1) ELISA kit

E03R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse RecQ mediated genome instability protein 1(RMI1) ELISA kit

E03R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse RecQ mediated genome instability protein 1(RMI1) ELISA kit

E03R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RecQ mediated genome instability protein 1(RMI1) ELISA kit

E04R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RecQ mediated genome instability protein 1(RMI1) ELISA kit

E04R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RecQ mediated genome instability protein 1(RMI1) ELISA kit

E04R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ mediated genome instability protein 1(RMI1) ELISA kit

E01R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ mediated genome instability protein 1(RMI1) ELISA kit

E01R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ mediated genome instability protein 1(RMI1) ELISA kit

E01R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E06R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E06R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E06R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E07R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E07R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E07R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog RecQ mediated genome instability protein 1(RMI1) ELISA kit

E08R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog RecQ mediated genome instability protein 1(RMI1) ELISA kit

E08R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog RecQ mediated genome instability protein 1(RMI1) ELISA kit

E08R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey RecQ mediated genome instability protein 1(RMI1) ELISA kit

E09R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey RecQ mediated genome instability protein 1(RMI1) ELISA kit

E09R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey RecQ mediated genome instability protein 1(RMI1) ELISA kit

E09R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ-mediated genome instability protein 1 (RMI1) ELISA Kit

abx382828-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse RecQ-mediated genome instability protein 1 (RMI1) ELISA Kit

abx389563-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RMI1 ELISA Kit| chicken RecQ-mediated genome instability protei

EF012342 96 Tests
EUR 689

Guinea pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E05R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E05R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E05R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RecQ-Mediated Genome Instability Protein 2 (RMI2) Antibody

20-abx005864
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rmi2 ELISA Kit| Mouse RecQ-mediated genome instability protein

EF016112 96 Tests
EUR 689

RMI2 ELISA Kit| Bovine RecQ-mediated genome instability protein

EF011868 96 Tests
EUR 689

RMI2 ELISA Kit| chicken RecQ-mediated genome instability protei

EF012499 96 Tests
EUR 689

Human RecQ-mediated genome instability protein 2 (RMI2) ELISA Kit

abx385375-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse RecQ-mediated genome instability protein 2 (RMI2) ELISA Kit

abx390470-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human RecQ-mediated genome instability protein 2 (C16orf75)

KTE62201-48T 48T
EUR 332
  • RMI2 is a component of the BLM (RECQL3
  • MIM 604610) complex, which plays a role in homologous recombination-dependent DNA repair and is essential for genome stability.
Description: Quantitative sandwich ELISA for measuring Human RecQ-mediated genome instability protein 2 (C16orf75) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human RecQ-mediated genome instability protein 2 (C16orf75)

KTE62201-5platesof96wells 5 plates of 96 wells
EUR 2115
  • RMI2 is a component of the BLM (RECQL3
  • MIM 604610) complex, which plays a role in homologous recombination-dependent DNA repair and is essential for genome stability.
Description: Quantitative sandwich ELISA for measuring Human RecQ-mediated genome instability protein 2 (C16orf75) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human RecQ-mediated genome instability protein 2 (C16orf75)

KTE62201-96T 96T
EUR 539
  • RMI2 is a component of the BLM (RECQL3
  • MIM 604610) complex, which plays a role in homologous recombination-dependent DNA repair and is essential for genome stability.
Description: Quantitative sandwich ELISA for measuring Human RecQ-mediated genome instability protein 2 (C16orf75) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

recQ Antibody

1-CSB-PA17979A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against recQ. Recognizes recQ from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RMI1 siRNA

20-abx931600
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RMI1 siRNA

20-abx931601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RMI1 antibody

70R-5555 50 ug
EUR 467
Description: Rabbit polyclonal RMI1 antibody

RMI1 antibody

70R-19909 50 ul
EUR 435
Description: Rabbit polyclonal RMI1 antibody

RMI1 Antibody

1-CSB-PA875699LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RMI1 Antibody

DF12724 200ul
EUR 304
Description: RMI1 Antibody detects endogenous levels of RMI1.

RMI1 Antibody

1-CSB-PA019754GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RMI1 Recombinant Protein (Human)

RP026503 100 ug Ask for price

RMI1 Recombinant Protein (Mouse)

RP168335 100 ug Ask for price

RMI1 Recombinant Protein (Mouse)

RP168338 100 ug Ask for price

Escherichia coli ATP-dependent DNA helicase recQ (recQ)

1-CSB-RP179794Ba
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli ATP-dependent DNA helicase recQ(recQ),partial expressed in E.coli

recQ Polyclonal Antibody

A52364 100 µg
EUR 570.55
Description: The best epigenetics products

RecQ Polyclonal Antibody

42617-100ul 100ul
EUR 333

anti- RMI1 antibody

FNab07321 100µg
EUR 585
  • Immunogen: RMI1, RecQ mediated genome instability 1, homolog(S. cerevisiae)
  • Uniprot ID: Q9H9A7
  • Gene ID: 80010
  • Research Area: Metabolism
Description: Antibody raised against RMI1

RMI1 Rabbit pAb

A4991-100ul 100 ul
EUR 308

RMI1 Rabbit pAb

A4991-200ul 200 ul
EUR 459

RMI1 Rabbit pAb

A4991-20ul 20 ul
EUR 183

RMI1 Rabbit pAb

A4991-50ul 50 ul
EUR 223

RMI1 Polyclonal Antibody

A67578 100 µg
EUR 570.55
Description: The best epigenetics products

RMI1 Blocking Peptide

33R-1953 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RMI1 antibody, catalog no. 70R-5555

RMI1 Polyclonal Antibody

30629-100ul 100ul
EUR 252

RMI1 Polyclonal Antibody

30629-50ul 50ul
EUR 187

RMI1 cloning plasmid

CSB-CL875699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgaatgtgactagtattgcattaagagctgaaacttggcttttagctgcatggcatgttaaagtacctccgatgtggctggaagcttgtattaactggattcaagaagaaaataataatgttaacttgagtcaggcccaaatgaataaacaagtgtttgagcagtggctcctta
  • Show more
Description: A cloning plasmid for the RMI1 gene.

RMI1 Blocking Peptide

DF12724-BP 1mg
EUR 195

Anti-RMI1 antibody

PAab07321 100 ug
EUR 412

Anti-RMI1 antibody

STJ25361 100 µl
EUR 277

Recombinant Pasteurella Multocida recQ Protein (aa 1-632)

VAng-Cr7256-inquire inquire Ask for price
Description: Pasteurella Multocida (strain Pm70) ATP-dependent DNA helicase recQ (recQ), recombinant protein.

Genome Polyprotein Antibody

20-abx109417
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody

20-abx300967
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody

1-CSB-PA362073LA01HQD
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Genome polyprotein. Recognizes Genome polyprotein from Human rhinovirus A serotype 89. This antibody is Unconjugated. Tested in the following application: ELISA

Genome polyprotein Antibody

1-CSB-PA333180LA01HFD
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Genome polyprotein. Recognizes Genome polyprotein from Hepatitis C virus genotype 1a. This antibody is Unconjugated. Tested in the following application: ELISA

Genome polyprotein Antibody

1-CSB-PA714772LA01HYH
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Genome polyprotein. Recognizes Genome polyprotein from Human enterovirus 71. This antibody is Unconjugated. Tested in the following application: ELISA

Genome polyprotein Antibody

1-CSB-PA18549A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Genome polyprotein. Recognizes Genome polyprotein from Dengue virus. This antibody is Unconjugated. Tested in the following application: ELISA

RecQ Polyclonal Conjugated Antibody

C42617 100ul
EUR 397

recQ Antibody, HRP conjugated

1-CSB-PA17979B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against recQ. Recognizes recQ from Escherichia coli. This antibody is HRP conjugated. Tested in the following application: ELISA

recQ Antibody, FITC conjugated

1-CSB-PA17979C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against recQ. Recognizes recQ from Escherichia coli. This antibody is FITC conjugated. Tested in the following application: ELISA

recQ Antibody, Biotin conjugated

1-CSB-PA17979D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against recQ. Recognizes recQ from Escherichia coli. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recq Protein-Like 4 (RECQL4) Antibody

20-abx115094
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recq Protein-Like 5 (RECQL5) Antibody

20-abx115095
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant YFV Genome polyprotein Protein (aa 1-101)

VAng-Cr6542-1mgEcoli 1 mg (E. coli)
EUR 2840
Description: YFV Genome polyprotein, recombinant protein.

Recombinant YFV Genome polyprotein Protein (aa 1-101)

VAng-Cr6542-500gEcoli 500 µg (E. coli)
EUR 2044
Description: YFV Genome polyprotein, recombinant protein.

Recombinant YFV Genome polyprotein Protein (aa 1-101)

VAng-Cr6542-50gEcoli 50 µg (E. coli)
EUR 1411
Description: YFV Genome polyprotein, recombinant protein.

RMI1 Polyclonal Conjugated Antibody

C30629 100ul
EUR 397

Mouse RMI1 shRNA Plasmid

20-abx978212
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RMI1 shRNA Plasmid

20-abx962721
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RMI1 ELISA KIT

ELI-14504h 96 Tests
EUR 824

Bovine RMI1 ELISA KIT

ELI-20347b 96 Tests
EUR 928

Chicken RMI1 ELISA KIT

ELI-20348c 96 Tests
EUR 928

RMI1 ELISA KIT|Human

EF002488 96 Tests
EUR 689

Mouse Rmi1 ELISA KIT

ELI-38860m 96 Tests
EUR 865

RMI1 Antibody, HRP conjugated

1-CSB-PA875699LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RMI1 Antibody, FITC conjugated

1-CSB-PA875699LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RMI1 Antibody, Biotin conjugated

1-CSB-PA875699LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pCMV-SPORT6-RMI1 Plasmid

PVT16836 2 ug
EUR 325

RMI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1827702 1.0 ug DNA
EUR 154

Rmi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4476602 1.0 ug DNA
EUR 154

Genome polyprotein Antibody (HRP)

20-abx109095
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome Polyprotein Antibody (Biotin)

20-abx105887
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody (Biotin)

20-abx106264
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody (FITC)

20-abx107678
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody (HRP)

20-abx300968
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody (FITC)

20-abx300969
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome polyprotein Antibody (Biotin)

20-abx300970
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome Polyprotein Polyclonal Antibody

A56743 100 µg
EUR 570.55
Description: Ask the seller for details

Genome Polyprotein Polyclonal Antibody

A56130 100 µg
EUR 570.55
Description: Ask the seller for details

Genome Polyprotein Polyclonal Antibody

A68253 100 µg
EUR 570.55
Description: Ask the seller for details

Genome Polyprotein Polyclonal Antibody

A68254 100 µg
EUR 570.55
Description: reagents widely cited

Hepatitis C Genome polyprotein

1-CSB-RP184674Ba
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Hepatitis C Genome polyprotein expressed in E.coli

Recombinant YFV Genome polyprotein (NS4A) Protein (aa 1-3412)

VAng-Cr6545-inquire inquire Ask for price
Description: YFV (isolate Uganda/A7094A4/1948) Genome polyprotein (NS4A), recombinant protein.

Mitochondrial Genome Maintenance Exonuclease 1 (MGME1) Antibody

abx235168-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mitochondrial Genome Maintenance Exonuclease 1 (MGME1) Antibody

20-abx302859
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

recQ Polyclonal Antibody, Biotin Conjugated

A52361 100 µg
EUR 570.55
Description: Ask the seller for details

recQ Polyclonal Antibody, FITC Conjugated

A52362 100 µg
EUR 570.55
Description: The best epigenetics products

recQ Polyclonal Antibody, HRP Conjugated

A52363 100 µg
EUR 570.55
Description: kits suitable for this type of research

E. coli RecQ DNA helicase

01-003 50 ug
EUR 479
Description: The E. coli RecQ DNA helicase is available in Europe and for worldwide shipping via Gentaur.

E. coli RecQ DNA helicase

01-004 250? g
EUR 1549
Description: The E. coli RecQ DNA helicase is available in Europe and for worldwide shipping via Gentaur.

RMI1 Protein Vector (Human) (pPB-C-His)

PV035337 500 ng
EUR 329

RMI1 Protein Vector (Human) (pPB-N-His)

PV035338 500 ng
EUR 329

RMI1 Protein Vector (Human) (pPM-C-HA)

PV035339 500 ng
EUR 329

RMI1 Protein Vector (Human) (pPM-C-His)

PV035340 500 ng
EUR 329

RMI1 Protein Vector (Mouse) (pPB-C-His)

PV224450 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPB-N-His)

PV224451 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-HA)

PV224452 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-His)

PV224453 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPB-C-His)

PV224454 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPB-N-His)

PV224455 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-HA)

PV224456 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-His)

PV224457 500 ng
EUR 603

RMI1 Polyclonal Antibody, HRP Conjugated

A67579 100 µg
EUR 570.55
Description: kits suitable for this type of research

RMI1 Polyclonal Antibody, FITC Conjugated

A67580 100 µg
EUR 570.55
Description: fast delivery possible

RMI1 Polyclonal Antibody, Biotin Conjugated

A67581 100 µg
EUR 570.55
Description: reagents widely cited

RMI1 ORF Vector (Human) (pORF)

ORF008835 1.0 ug DNA
EUR 95

Rmi1 ORF Vector (Mouse) (pORF)

ORF056113 1.0 ug DNA
EUR 506

Rmi1 ORF Vector (Mouse) (pORF)

ORF056114 1.0 ug DNA
EUR 506

Mitochondrial Genome Maintenance Exonuclease 1 (MGME1) Antibody (HRP)

20-abx311506
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitochondrial Genome Maintenance Exonuclease 1 (MGME1) Antibody (FITC)

20-abx311507
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitochondrial Genome Maintenance Exonuclease 1 (MGME1) Antibody (Biotin)

20-abx311508
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

P62-mediated mitophagy inducer

HY-115576 25mg
EUR 423

Genome edited iPSCs (KO) PARK2-/-

ASE-9400 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) PARK7-/-

ASE-9401 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) PINK1-/-

ASE-9402 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) LRRK2-/-

ASE-9403 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) BDNF-/-

ASE-9404 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) APOE-/-

ASE-9405 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) DISC1-/-

ASE-9406 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) SOD1-/-

ASE-9407 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Genome edited iPSCs (KO) CNTNAP2-/-

ASE-9408 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Enterovirus 71 Genome polyprotein Antibody

20-abx109758
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genome Polyprotein (HCV-Core) Antibody

33487-05111 150 ug
EUR 261

Human rhinovirus 1A Genome polyprotein

1-CSB-YP326367HQA
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human rhinovirus 1A Genome polyprotein,partial expressed in Yeast

Genome polyprotein Antibody, HRP conjugated

1-CSB-PA362073LB01HQD
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Genome polyprotein. Recognizes Genome polyprotein from Human rhinovirus A serotype 89. This antibody is HRP conjugated. Tested in the following application: ELISA

Genome polyprotein Antibody, FITC conjugated

1-CSB-PA362073LC01HQD
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Genome polyprotein. Recognizes Genome polyprotein from Human rhinovirus A serotype 89. This antibody is FITC conjugated. Tested in the following application: ELISA
Our outcomes present that, in human erythroid cells, the regulation of ATP2B4 gene expression is considerably affected by GATA1 expression, and we doc the position of particular SNPs concerned in predicted GATA1 binding. Our findings present a mechanistic clarification on the molecular degree for the decreased erythroid-specific PMCA4b expression in carriers of ATP2B4 gene polymorphic variants.

Leave a Reply

Your email address will not be published. Required fields are marked *